Author Correction: Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria

Chen Dong, Jason Fontana, Anika Patel, James M. Carothers () and Jesse G. Zalatan ()
Additional contact information
Chen Dong: University of Washington
Jason Fontana: University of Washington
Anika Patel: University of Washington
James M. Carothers: University of Washington
Jesse G. Zalatan: University of Washington

Nature Communications, 2018, vol. 9, issue 1, 1-1

Abstract: In the original version of the Supplementary Information file associated with this Article, the sequence ‘1x MS2 scRNA.b2’ was incorrectly given as ‘GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCGCACATGAGGATCACCCATGTGCTTTTTT’ and should have read ‘GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACATGAGGATCACCCATGTGCTTTTTTT’. The error has now been fixed and the corrected version of the Supplementary Information PDF is available to download from the HTML version of the Article.

Date: 2018
References: Add references at CitEc
Citations: View citations in EconPapers (5)

Downloads: (external link)
https://www.nature.com/articles/s41467-018-06909-4 Abstract (text/html)

Related works:
This item may be available elsewhere in EconPapers: Search for items with the same title.

Export reference: BibTeX RIS (EndNote, ProCite, RefMan) HTML/Text

Persistent link: https://EconPapers.repec.org/RePEc:nat:natcom:v:9:y:2018:i:1:d:10.1038_s41467-018-06909-4

Ordering information: This journal article can be ordered from
https://www.nature.com/ncomms/

DOI: 10.1038/s41467-018-06909-4

Access Statistics for this article

Nature Communications is currently edited by Nathalie Le Bot, Enda Bergin and Fiona Gillespie

More articles in Nature Communications from Nature
Bibliographic data for series maintained by Sonal Shukla () and Springer Nature Abstracting and Indexing ().