Correction: The limits of selection during maize domestication

Rong-Lin Wang, Adrian Stec, Jody Hey, Lewis Lukens and John Doebley

Nature, 2001, vol. 410, issue 6829, 718-718

Abstract: Nature 398 , 236 - 239 (1999 ). The primers used for PCR of the 3′ portion of tb1 amplified a duplicate locus (tb1 homeologue) in two samples (11 and 16). Inclusion of these homeologous sequences caused π to rise sharply at the 3′ end of the gene in Fig. 1. Using a new 3′ primer (gaggcatcatccagcagacgagaaa), tb1 sequences were re-isolated (Genbank accessions AF340187–AF340209).

Date: 2001
References: Add references at CitEc
Citations:

Downloads: (external link)
https://www.nature.com/articles/35070620 Abstract (text/html)
Access to the full text of the articles in this series is restricted.

Related works:
This item may be available elsewhere in EconPapers: Search for items with the same title.

Export reference: BibTeX RIS (EndNote, ProCite, RefMan) HTML/Text

Persistent link: https://EconPapers.repec.org/RePEc:nat:nature:v:410:y:2001:i:6829:d:10.1038_35070620

Ordering information: This journal article can be ordered from
https://www.nature.com/

DOI: 10.1038/35070620

Access Statistics for this article

Nature is currently edited by Magdalena Skipper

More articles in Nature from Nature
Bibliographic data for series maintained by Sonal Shukla () and Springer Nature Abstracting and Indexing ().